Bowtie Program Manual

File Name:Bowtie Program Manual.pdf


ENTER SITE »»» DOWNLOAD PDF


CLICK HERE »»» BOOK READER


Size: 1961 KB
Type: PDF, ePub, eBook
Uploaded: 10 May 2019, 16:45
Rating: 4.6/5 from 720 votes.
tatus: AVAILABLE
Last checked: 13 Minutes ago!
eBook includes PDF, ePub and Kindle version
In order to read or download Bowtie Program Manual ebook, you need to create a FREE account.

✔ Register a free 1 month Trial Account.
✔ Download as many books as you like (Personal use)
✔ Cancel the membership at any time if not satisfied.
✔ Join Over 80000 Happy Readers

Nature Methods. 2012, 9:357-359. Bioinformatics. bty648. Nature Methods. 2012, 9:357-359. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology 10:R25. It is particularly good at aligning reads of about 50 up to 100s of characters to relatively long (e.g. mammalian) genomes. Bowtie 2 indexes the genome with an FM Index (based on the Burrows-Wheeler Transform or BWT ) to keep its memory footprint small: for the human genome, its memory footprint is typically around 3.2 gigabytes of RAM. Bowtie 2 supports gapped, local, and paired-end alignment modes. Multiple processors can be used simultaneously to achieve greater alignment speed. Bowtie 2 is distributed under the GPLv3 license, and it runs on the command line under Windows, Mac OS X and Linux. Bowtie 2 and Bowtie (also called “ Bowtie 1 ” here) are also tightly integrated into many other tools, some of which are listed here. Papers describing Bowtie 2 are: Fast gapped-read alignment with Bowtie 2.Since then, technology has improved both sequencing throughput (more nucleotides produced per sequencer per day) and read length (more nucleotides per read). Number of gaps and gap lengths are not restricted, except by way of the configurable scoring scheme. Bowtie 1 finds just ungapped alignments. Local alignments might be “trimmed” (“soft clipped”) at one or both extremes in a way that optimizes alignment score. Bowtie 2 also supports end-to-end alignment which, like Bowtie 1, requires that the read align entirely. Bowtie 1 does not. In Bowtie 2 all alignments lie along a continuous spectrum of alignment scores where the scoring scheme, similar to Needleman-Wunsch and Smith-Waterman. That said, it handles arbitrarily small reference sequences (e.g. amplicons) and very long reads (i.e. upwards of 10s or 100s of kilobases), though it is slower in those settings. It is optimized for the read lengths and error modes yielded by typical Illumina sequencers. http://petpetmates.com/files/editor/braun-irt4520-manual.xml

bowtie program manual, bow tie program manual pdf, bow tie program manual download, bow tie program manual free, bow tie program manual template.

With Bioconda installed, you should be able to install Bowtie 2 with conda install bowtie2. If you plan to compile Bowtie 2 yourself, make sure to get the source package, i.e., the filename that ends in “-source.zip”. It should be possible to build Bowtie 2 on most vanilla Linux installations or on a Mac installation with Xcode installed. (But see note about the TBB library below). Bowtie 2 can also be built on Windows using a 64-bit MinGW distribution and MSYS. In order to simplify the MinGW setup it might be worth investigating popular MinGW personal builds since these are coming already prepared with most of the toolchains needed. Make sure you’re getting the source package; the file downloaded should end in -source.zip. Unzip the file, change to the unzipped directory, and build the Bowtie 2 tools by running GNU make (usually with the command make, but sometimes with gmake ) with no arguments. If building with MinGW, run make from the MSYS environment. By default, Bowtie 2 uses the Threading Building Blocks library (TBB) for this. The table below list some of the commands for a few of the more popular operating systems. Prepackaged builds will include a package that supports SRA. If you’re building bowtie2 from source please make sure that the Java runtime is available on your system.This is recommended for most users. To do this, follow your operating system’s instructions for adding the directory to your PATH. An “alignment” is a result from this process, specifically: an alignment is a way of “lining up” some or all of the characters in the read with some characters from the reference in a way that reveals how they’re similar. For example: It’s not always possible to determine this with certainty. For instance, if the reference genome contains several long stretches of As ( AAAAAAAAA etc.) and the read sequence is a short stretch of As ( AAAAAAA ), we cannot know for certain exactly where in the sea of A s the read originated. http://mpti.ru/userfiles/braun-juicer-4290-manual.xml

That is, it searches for alignments involving all of the read characters. This is also called an “untrimmed” or “unclipped” alignment. In this mode, Bowtie 2 might “trim” or “clip” some read characters from one or both ends of the alignment if doing so maximizes the alignment score. Such an alignment can be produced by Bowtie 2 in either end-to-end mode or in local mode. Reference: GACTGCGATCTCGACATCG. Alignment:In this case, 4 characters are omitted (or “soft trimmed” or “soft clipped”) from the beginning and 3 characters are omitted from the end. This sort of alignment can be produced by Bowtie 2 only in local mode. Reference: TAACTTGCGTTAAATCCGCCTGG. Alignment:The higher the score, the more similar they are. A score is calculated by subtracting penalties for each difference (mismatch, gap, etc.) and, in local alignment mode, adding bonuses for each match. A length-2 read gap receives a penalty of -11 by default (-5 for the gap open, -3 for the first extension, -3 for the second extension).A length-2 read gap receives a penalty of -11 by default (-5 for the gap open, -3 for the first extension, -3 for the second extension).This happens when there are no differences between the read and the reference. The threshold is configurable and is expressed as a function of the read length. This can be configured with the --score-min option. For details on how to set options like --score-min that correspond to functions, see the section on setting function options. For instance, a read that originated inside a repeat element might align equally well to many occurrences of the element throughout the genome, leaving the aligner with no basis for preferring one over the others. Mapping quality is sometimes abbreviated MAPQ, and is recorded in the SAM MAPQ field. The bigger the gap between the best alignment’s score and the second-best alignment’s score, the more unique the best alignment, and the higher its mapping quality should be. http://superbia.lgbt/flotaganis/1647547333

For instance, a variant caller might choose to ignore evidence from alignments with mapping quality less than, say, 10. A mapping quality of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere. Exactly what expectations hold for a given dataset depends on the lab procedures used to generate the data. For example, a common lab procedure for producing pairs is Illumina’s Paired-end Sequencing Assay, which yields pairs with a relative orientation of FR (“forward, reverse”) meaning that if mate 1 came from the Watson strand, mate 2 very likely came from the Crick strand and vice versa. Also, this protocol yields pairs where the expected genomic distance from end to end is about 200-500 base pairs. Depending on the protocol, these might actually be referred to as “paired-end” or “mate-paired.” Also, we always refer to the individual sequences making up the pair as “mates.” The first mate in the file for mate 1 forms a pair with the first mate in the file for mate 2, the second with the second, and so on. When aligning pairs with Bowtie 2, specify the file with the mate 1s mates using the -1 argument and the file with the mate 2s using the -2 argument. This causes Bowtie 2 to take the paired nature of the reads into account when aligning them. The first record describes the alignment for mate 1 and the second record describes the alignment for mate 2. In both records, some of the fields of the SAM record describe various properties of the alignment; for instance, the 7th and 8th fields ( RNEXT and PNEXT respectively) indicate the reference name and position where the other mate aligned, and the 9th field indicates the inferred length of the DNA fragment from which the two mates were sequenced. See the SAM specification for more details regarding these fields. If both mates have unique alignments, but the alignments do not match paired-end expectations (i.e. https://goldonresources.com/images/bowtie-alignment-manual.pdf

the mates aren’t in the expected relative orientation, or aren’t within the expected distance range, or both), the pair is said to align “discordantly”. Discordant alignments may be of particular interest, for instance, when seeking structural variants. The expected range of inter-mates distances (as measured from the furthest extremes of the mates; also called “outer distance”) is set with the -I and -X options. Note that setting -I and -X far apart makes Bowtie 2 slower. See documentation for -I and -X. This is a conservative threshold, but this is often desirable when seeking structural variants. This is called “mixed mode.” To disable mixed mode, set the --no-mixed option. The first (least significant) bit (1 in decimal, 0x1 in hexadecimal) is set if the read is part of a pair. The second bit (2 in decimal, 0x2 in hexadecimal) is set if the read is part of a pair that aligned in a paired-end fashion. The fourth bit (8 in decimal, 0x8 in hexadecimal) is set if the read is part of a pair and the other mate in the pair had at least one valid alignment. The sixth bit (32 in decimal, 0x20 in hexadecimal) is set if the read is part of a pair and the other mate in the pair aligned to the Crick strand (or, equivalently, if the reverse complement of the other mate aligned to the Watson strand). The seventh bit (64 in decimal, 0x40 in hexadecimal) is set if the read is mate 1 in a pair. The eighth bit (128 in decimal, 0x80 in hexadecimal) is set if the read is mate 2 in a pair. See the SAM specification for a more detailed description of the FLAGS field. A SAM optional field is formatted like this: “XP:i:1” where “XP” is the TAG, “i” is the TYPE (“integer” in this case), and “1” is the VALUE. See the SAM specification for details regarding SAM optional fields. Consider this example: Mate 2: TGTTTGGGGTGACACATTACGCGTCTTTGAC. Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC Mate 2: TGTTTGGGGTGACACATTACGC. https://snabavto.com/wp-content/plugins/formcraft/file-upload/server/content/files/1627555200a666---brother-p-touch-1800-manual-1.pdf

Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC. Mate 1: CAGCTACGATATTGTTTGGGGTGACACATTACGC. Mate 2: CTACGATATTGTTTGGGGTGAC. Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC Mate 2: TATGAGTCAGCTACGATATTGTTTGGGGTGACACAT. Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC Bowtie 2’s default behavior is to consider overlapping and containing as being consistent with concordant alignment. By default, dovetailing is considered inconsistent with concordant alignment. Setting --no-overlap causes Bowtie 2 to consider overlapping mates as non-concordant. Setting --no-contain causes Bowtie 2 to consider cases where one mate alignment contains the other as non-concordant. Setting --dovetail causes Bowtie 2 to consider cases where the mate alignments dovetail as concordant. Bowtie 2 has three distinct reporting modes. The default reporting mode is similar to the default reporting mode of many other read alignment tools, including BWA. It is also similar to Bowtie 1’s -M alignment mode. When we say that a read has multiple alignments, we mean that it has multiple alignments that are valid and distinct from one another. Specifically, we say that two alignments are distinct if there are no alignment positions where a particular read offset is aligned opposite a particular reference offset in both alignments with the same orientation. E.g. if the first alignment is in the forward orientation and aligns the read character at read offset 10 to the reference character at chromosome 3, offset 3,445,245, and the second alignment is also in the forward orientation and also aligns the read character at read offset 10 to the reference character at chromosome 3, offset 3,445,245, they are not distinct alignments. When it finds a valid alignment, it generally will continue to look for alignments that are nearly as good or better. accofire.com/ckfinder/userfiles/files/casio-ctk-533-keyboard-manual.pdf

It will eventually stop looking, either because it exceeded a limit placed on search effort (see -D and -R ) or because it already knows all it needs to know to report an alignment. Information from the best alignments are used to estimate mapping quality (the MAPQ SAM field) and to set SAM optional fields, such as AS:i and XS:i. Bowtie 2 does not guarantee that the alignment reported is the best possible in terms of alignment score. Increasing -D makes Bowtie 2 slower, but increases the likelihood that it will report the correct alignment for a read that aligns many places. Increasing -R makes Bowtie 2 slower, but increases the likelihood that it will report the correct alignment for a read that aligns many places. That is, if -k 2 is specified, Bowtie 2 will search for at most 2 distinct alignments. It reports all alignments found, in descending order by alignment score. The alignment score for a paired-end alignment equals the sum of the alignment scores of the individual mates. Supplementary alignments will also be assigned a MAPQ of 255. See the SAM specification for details. Still, this mode can be effective and fast in situations where the user cares more about whether a read aligns (or aligns a certain number of times) than where exactly it originated. Alignments are reported in descending order by alignment score. Supplementary alignments will be assigned a MAPQ of 255. See the SAM specification for details. Bowtie 2 is not! For very large genomes, this mode is very slow. For example, if Bowtie 2 discovers a set of 3 equally-good alignments and wants to decide which to report, it picks a pseudo-random integer 0, 1 or 2 and reports the corresponding alignment. Arbitrary choices can crop up at various points during alignment. If you run the same version of Bowtie 2 on two reads with identical names, nucleotide strings, and quality strings, and if --seed is set the same for both runs, Bowtie 2 will produce the same output; i.e. {-Variable.fc_1_url-

, it will align the read to the same place, even if there are multiple equally good alignments. This is intuitive and desirable in most cases. Most users expect Bowtie to produce the same output when run twice on the same input. When this is specified, Bowtie 2 might report different alignments for identical reads. This is counter-intuitive for some users, but might be more appropriate in situations where the input consists of many identical reads. This is “multiseed alignment” and it is similar to what Bowtie 1 does, except Bowtie 1 attempts to align the entire read this way. For instance, it is possible for a read to have a valid overall alignment but to have no valid seed alignments because each potential seed alignment is interrupted by too many mismatches or gaps. You can adjust these options one-by-one, though Bowtie 2 comes with some useful combinations of options prepackaged as “ preset options.” This step accounts for the bulk of Bowtie 2’s memory footprint, as the FM Index itself is typically the largest data structure used. For instance, the memory footprint of the FM Index for the human genome is about 3.2 gigabytes of RAM. Bowtie 2 considers all ambiguous characters in the reference (including IUPAC nucleotide codes ) to be Ns. An alignment position that contains an ambiguous character in the read, reference, or both, is penalized according to --np. --n-ceil sets an upper limit on the number of positions that may contain ambiguous reference characters in a valid alignment. The optional field XN:i reports the number of ambiguous reference characters overlapped by an alignment. For an alignment overlapping an ambiguous reference character to be found, it must have one or more seed alignments that do not overlap ambiguous reference characters. See the documentation for the preset options for details. https://www.northamericatalk.com/wp-content/plugins/formcraft/file-upload/server/content/files/1627555420dfe9---brother-p-touch-2450-dx-manual.pdf

Bowtie 2 will still print a SAM record for such a read, but no alignment will be reported and the YF:i SAM optional field will be set to indicate the reason the read was filtered. This only happens when the input is in Illumina’s QSEQ format (i.e. when --qseq is specified) and the last (11th) field of the read’s QSEQ record contains 1. These messages are printed to the “standard error” (“stderr”) filehandle. For datasets consisting of unpaired reads, the summary might look like this: The wrappers shield users from having to distinguish between “small” and “large” index formats, discussed briefly in the following section. Also, the bowtie2 wrapper provides some key functionality, like the ability to handle compressed inputs, and the functionality for --un, --al and related options. For genomes less than about 4 billion nucleotides in length, bowtie2-build builds a “small” index using 32-bit numbers in various parts of the index. When the genome is longer, bowtie2-build builds a “large” index using 64-bit numbers. Small indexes are stored in files with the.bt2 extension, and large indexes are stored in files with the.bt2l extension. The user need not worry about whether a particular index is small or large; the wrapper scripts will automatically build and use the appropriate index. A denser SA sample yields a larger index, but is also particularly effective at speeding up alignment when many alignments are reported per read. This decreases the memory footprint of the index. In these cases the user specifies three parameters: (a) a function type F, (b) a constant term B, and (c) a coefficient A. The available function types are constant ( C ), linear ( L ), square-root ( S ), and natural log ( G ). The parameters are specified as F,B,A - that is, the function type, the constant term, and the coefficient are separated by commas with no whitespace. http://www.abvent.com/emailing/files/casio-ctk-519-manual.pdf

For example, in the case if the --score-min option, the function f(x) sets the minimum alignment score necessary for an alignment to be considered valid, and x is the read length. If - is specified, bowtie2 will read the mate 1s from the “standard in” or “stdin” filehandle. If - is specified, bowtie2 will read the mate 2s from the “standard in” or “stdin” filehandle. If - is specified, bowtie2 gets the reads from the “standard in” or “stdin” filehandle. If the accession provided cannot be found in local storage it will be fetched from the NCBI database.See Obtaining Bowtie 2 for details. The --align-paired-reads and --preserve-tags options affect the way Bowtie 2 processes records. By default, alignments are written to the “standard out” or “stdout” filehandle (i.e. the console). FASTQ files usually have extension.fq or.fastq. FASTQ is the default format. See also: --solexa-quals and --int-quals. An input file can be a mix of unpaired and paired-end reads and Bowtie 2 recognizes each according to the number of fields, handling each as it should. FASTA files usually have extension.fa,.fasta,.mfa,.fna or similar. FASTA files do not have a way of specifying quality values, so when -f is set, the result is as if --ignore-quals is also set. When -r is set, the result is as if --ignore-quals is also set. Each k-mer is aligned as a separate read. Quality values are set to all Is (40 on Phred scale). Only single k-mers, i.e. unpaired reads, can be aligned in this way.There is no way to specify read names or qualities, so -c also implies --ignore-quals. Bases will be trimmed from either the 3’ (right) or 5’ (left) end of the read.This scheme was used in older Illumina GA Pipeline versions (prior to 1.3). Default: off. Can be set to 0 or 1. Setting this higher makes alignment slower (often much slower) but increases sensitivity. Default: 0. Smaller values make alignment slower but more sensitive. Default: the --sensitive preset is used by default, which sets -L to 22 and 20 in --end-to-end mode and in --local mode. For instance, if the read has 30 characters, and seed length is 10, and the seed interval is 6, the seeds extracted will be: Seed 1 fw: TAGCTACGCT. Seed 1 rc: AGCGTAGCTA. Seed 2 fw: CGCTCTACGC. Seed 2 rc: GCGTAGAGCG. Seed 3 fw: ACGCTATCAT. Seed 3 rc: ATGATAGCGT. Seed 4 fw: TCATGCATAA. Seed 4 rc: TTATGCATGA See also: setting function options. If the function returns a result less than 1, it is rounded up to 1. Default: the --sensitive preset is used by default, which sets -i to S,1,1.15 in --end-to-end mode to -i S,1,0.75 in --local mode. See also: setting function options. Reads exceeding this ceiling are filtered out. Default: L,0,0.15. Default: 15. This is also the default behavior when the input doesn’t specify quality values (e.g. in -f, -r, or -c modes). If --norc is specified, bowtie2 will not attempt to align unpaired reads against the reverse-complement (Crick) reference strand. In paired-end mode, --nofw and --norc pertain to the fragments; i.e. specifying --nofw causes bowtie2 to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default: both strands enabled. Such alignments can be found very quickly, and many short read alignments have exact or near-exact end-to-end alignments. However, this can lead to unexpected alignments when the user also sets options governing the multiseed heuristic, like -L and -N. For instance, if the user specifies -N 0 and -L equal to the length of the read, the user will be surprised to find 1-mismatch alignments reported. This option prevents Bowtie 2 from searching for 1-mismatch end-to-end alignments before using the multiseed heuristic, which leads to the expected behavior when combined with options such as -L and -N. This comes at the expense of speed. The match bonus --ma always equals 0 in this mode, so all alignment scores are less than or equal to 0, and the greatest possible alignment score is 0. This is mutually exclusive with --local. --end-to-end is the default mode. Rather, some characters may be omitted (“soft clipped”) from the ends in order to achieve the greatest possible alignment score. The match bonus --ma is used in this mode, and the best possible alignment score is equal to the match bonus ( --ma ) times the length of the read. Specifying --local and one of the presets (e.g. --local --very-fast ) is equivalent to specifying the local version of the preset ( --very-fast-local ). This is mutually exclusive with --end-to-end. --end-to-end is the default mode. In --local mode is added to the alignment score for each position where a read character aligns to a reference character and the characters match. Not used in --end-to-end mode. Default: 2. A number less than or equal to MX and greater than or equal to MN is subtracted from the alignment score for each position where a read character aligns to a reference character, the characters do not match, and neither is an N. If --ignore-quals is specified, the number subtracted quals MX.Default: 5, 3. Default: 5, 3. This is a function of read length. See also: setting function options. The default in --end-to-end mode is L,-0.6,-0.6 and the default in --local mode is G,20,8. When it finds a valid alignment, it continues looking for alignments that are nearly as good or better. The best alignment found is reported (randomly selected from among best if tied). Information about the best alignments is used to estimate mapping quality and to set SAM optional fields, such as AS:i and XS:i. Instead, it searches for at most distinct, valid alignments for each read. The search terminates when it can’t find more distinct valid alignments, or when it finds, whichever happens first. All alignments found are reported in descending order by alignment score. For reads that have more than distinct, valid alignments, bowtie2 does not guarantee that the alignments reported are the best possible in terms of alignment score. -k is mutually exclusive with -a. A seed extension “fails” if it does not yield a new best or a new second-best alignment. This limit is automatically adjusted up when -k or -a are specified. Default: 15. When “re-seeding,” Bowtie 2 simply chooses a new set of reads (same length, same number of mismatches allowed) at different offsets and searches for more alignments. A read is considered to have repetitive seeds if the total number of seed hits divided by the number of seeds that aligned at least once is greater than 300. Default: 2. A 19-bp gap would not be valid in that case. If trimming options -3 or -5 are also used, the -I constraint is applied with respect to the untrimmed mates. This is because larger differences between -I and -X require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. A 61-bp gap would not be valid in that case. If trimming options -3 or -5 are also used, the -X constraint is applied with respect to the untrimmed mates, not the trimmed mates. This is because larger differences between -I and -X require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. Default: --fr (appropriate for Illumina’s Paired-end Sequencing Assay). This option disables that behavior. This option disables that behavior. See also: Mates can overlap, contain or dovetail each other. Default: mates cannot dovetail in a concordant alignment. See also: Mates can overlap, contain or dovetail each other. Default: a mate can contain the other in a concordant alignment. See also: Mates can overlap, contain or dovetail each other. Default: mates can overlap in a concordant alignment. Use this option to align paired-end reads instead. This is printed to the “standard error” (“stderr”) filehandle. Default: off. These reads correspond to the SAM records with the FLAGS 0x4 bit set and neither the 0x40 nor 0x80 bits set. If --un-gz is specified, output will be gzip compressed. If --un-bz2 or --un-lz4 is specified, output will be bzip2 or lz4 compressed. Reads written in this way will appear exactly as they did in the input file, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the input. These reads correspond to the SAM records with the FLAGS 0x4, 0x40, and 0x80 bits unset. If --al-gz is specified, output will be gzip compressed. If --al-bz2 is specified, output will be bzip2 compressed. Similarly if --al-lz4 is specified, output will be lz4 compressed. Reads will not necessarily appear in the same order as they did in the input. Otherwise,.1 or.2 are added before the final dot in to make the per-mate filenames. Reads written in this way will appear exactly as they did in the input files, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the inputs. Otherwise,.1 or.2 are added before the final dot in to make the per-mate filenames. Reads will not necessarily appear in the same order as they did in the inputs. Having alignment metric can be useful for debugging certain problems, especially performance issues. See also: --met. Default: metrics disabled. This is not mutually exclusive with --met-file. Having alignment metric can be useful for debugging certain problems, especially performance issues. See also: --met. Default: metrics disabled. Only matters if either --met-stderr or --met-file are specified. Default: 1. It also causes the RG:Z: extra field to be attached to each SAM output record, with value set to. Specify --rg multiple times to set multiple fields. See the SAM Spec for details about what fields are legal. Specifying this option causes Bowtie 2 to print an asterisk in those fields instead. Only available in --local mode. If is greater than the offrate used to build the index, then some row markings are discarded when the index is read into memory. This reduces the memory footprint of the aligner but requires more time to calculate text offsets.Searching for alignments is highly parallel, and speedup is close to linear. Increasing -p increases Bowtie 2’s memory footprint. E.g. when aligning to a human genome index, increasing -p from 1 to 8 increases the memory footprint by a few hundred megabytes.Has no effect if -p is set to 1, since output order will naturally correspond to input order in that case. Only has an effect when read format is --qseq. Default: off. It seeds the generator with a number derived from (a) the read name, (b) the nucleotide sequence, (c) the quality sequence, (d) the value of the --seed option. This means that if two reads are identical (same name, same nucleotides, same qualities) Bowtie 2 will find and report the same alignment(s) for both, even if there was ambiguity. When --non-deterministic is specified, Bowtie 2 re-initializes its pseudo-random generator for each read using the current time. This means that Bowtie 2 will not necessarily report the same alignment for two identical reads. This is counter-intuitive for some users, but might be more appropriate in situations where the input consists of many identical reads. For more details, see the SAM format specification. Each line is a collection of at least 12 fields separated by tabs; from left to right, the fields are: If the read name contains any whitespace characters, Bowtie 2 will truncate the name at the first whitespace character.